We are all mutants

Mutations have a very bad reputation. I think that the reason for this is that in many cases, at least in biomedicine, certain diseases are described in terms of changes from “normal” function. For example the “cystic fibrosis gene” (this is a particularly nasty disease) is not *for* cystic fibrosis. It is a normal gene that when damaged it results in the pathological condition. In movies/series like the X-Men for example, even though mutants may possess special (and sometimes really, really cool) powers, these are oftentimes seen as double-edge swords (sociological and psychological commentaries are WAY beyond my expertise, and even though that has not stopped me before, I will not even try now).

Also, please keep in mind that in the real world, mutations do not give us superpowers …(:-)…

The thing is that strictly speaking, mutations are changes in the sequence of DNA within cells, nothing more, nothing less. Before we go any further, let’s briefly go over what DNA is and why should we care.

DNA (if you want to see what DNA stands for go here) is the type of molecule that ultimately stores the series of instructions that determine what living organisms (and wome viruses) look and work. At some point, you have seen in science fiction movies like Jurassic Park for example, strings of letters that represent the sequence of DNA and these a rather commonly displayed in police shows.

These strings are composed of only four letters (ATGC), and they usually are very, very long in various combinations, called sequences. By the way, there is even a sci-fi (-ish) movie titled GATTACA.

Anyway, you may have seen these DNA strings represented more or less like this:

…ATGCATTATATTACCGCTACGCGAGCTATGCTCGATATGC
TAGTAGTAGCATGCTAGTAGCTAGTCGATGTGCTACGTAGT
AGTAGCTAGTCGTCATGTAGTGCTGACTGATGTAGCTAGCT
ATCGCGCGCGCGGCGTATATCATCGCGTAGTACTCTGCAAG
TGTCATATCCAGTACGTCGTACGTCGTGTACGTCAGTCGTC
GTCAGTACGTAGTACGTCAGTCATACGTCGTCGTCAGTATG
ACGTCTTCGTAGAGCGCGCTTGCT…

Each of these letters represents a unit called a nucleotide, but we do not need to know more about them in this post. These four letters are the alphabet of the language of life. There is a special rule in this language; besides having just four letters, this language can only have words three-letters long. Therefore, a string of nucleotides like this one:

…ATGCATTATATTACCGCTACGCGAGCTATGCTCGATATG…

is actually meant to be read as:

…ATG-CAT-TAT-ATT-ACC-GCT-ACG-CGA-GCT-ATG-CTC-GAT-ATG…

Each of these word triplets code for a specific amino acid, which I discussed in a little more detail here, but briefly, amino acids are the building blocks that life uses to make proteins. Life as we know it uses about 20 amino acids or so, each of them with a distinct structure that determines its chemical behavior.

Slide3

Picture credit: http://www.ctahr.hawaii.edu/huen/aminoacids_files/aminoacids_data/aminoacids.gif

Now remember that each triplet represents the code for an amino acid. This presents us with a curious problem.

The problem is that if we have four letters (ATGC) that can only be arranged in three-lettered words, we have a grand total of 64 possible triplet combinations (I did the math for you). This implies that since life only uses 20 amino acids, there can be multiple combinations of DNA triplets that code for the same amino acid. This means that this genetic code shows some redundancy. Each amino acid, with the exception of two out of the 20 (one of them serves as the initiation amino acid, with is obviously coded by the initiation triplet), are coded by more than one triplet; incidentally these triplets are called Codons. In addition to codons for amino acids, there are initiation and termination codons, which are exactly what they sound like. They signal the start or the ending of the protein synthesis process.

***The information encoded in DNA is transferred to another type of molecule called RNA (think about DNA as the information stored in your computer’s hard drive and RNA as the information copied in a flash drive for example); we’ll skip this step in this discussion.***

Each of these codons eventually determines which amino acid will be at a specific position in a protein. Changes in the amino acid composition can change the protein’s function to various extents depending on the specific nature of the change.

As we said before, a mutation means any change on the DNA sequence, which can affect one or more codons. There are four basic scenarios for his eventuality. The first three usually deal with changes in just one of the nucleotides of a codon. Let’s take a look at them.

A silent mutation occurs when the change in the codon sequence does not change the amino acid in the protein (remember that most amino acids can be coded by more than one codon). There is no apparent change of structure and therefore no change in the function in the protein; no harm, no foul.

A missense mutation occurs when the change in the codon sequence results in a different amino acid. This can affect the function of the protein with various degrees of severity, depending on the type and position of the changed amino acid.

A nonsense mutation occurs when the codon changes into a stop codon. This will result in a shorter than normal protein. Again, the severity of the change will depend on the cutoff position. It stand to reason that a 100-amino acids protein truncated at amino acid #25 will be more damaged than a protein truncated at amino acid # 98 for example. By the way, when a codon is changed by mistake to an initiation codon, it only adds the initiation amino acid; this essentially works as a missense mutation.

Then there is the fourth kind…

This has the potential of being a really, really bad type of mutation. In this case, more than one codon is changed, either by addition or deletion of more than one nucleotide, usually in numbers not divisible by three (remember that a codon has three letters). The most extreme consequence of such mutation is the complete change in a protein sequence; essentially, we will have a completely different protein. This is called a frameshift mutation.

mutat

Picture credit: http://mol-biol4masters.masters.grkraj.org/html/DNA_Damage_And_Repair2-Types_of_Damages_and_Effects_files/image004.jpg

The usual way in which I explain frameshift mutations to my students is by imagining a multiple-choice exam gone wrong. For example, let’s suppose that the exam has 50 questions:

**You answer questions 1 to 5 in an uneventful manner.

**Then for some reason you get distracted and skip question 6 and answer question 7 thinking that you answered question 6.

**Of course, you will then answer question 8 thinking that you answered question 7

***Etc., you get the idea.

**Therefore, from question 6 on, all your intended answers are not what you meant to answer.

**You may get incredibly lucky and get the questions right, but this has an extremely low probability of happening. The most likely scenario is that after question 6 all your answers will be wrong.

***In technical terms, you are doomed, I’m telling you, dooooomed!.

Of course, as in the case of nonsense mutations, the degree of the damage will depend on the place where the mistake occurred, early or late in the process of protein synthesis.

Ok, why are we all mutants then?

Well, not all mutations are harmful. Changes in the DNA sequence, even is the change the amino acid at a specific position do not necessarily changes too much the protein function. Furthermore, some changes are neutral in the sense that changes in proteins may result in structural changes at the level of the organism which do not always are related to survival value. Here are some examples (Note: This is based on a general biology laboratory exercise in the lab manual that I co-wrote for our students. Picture credits are included in the figures):

Slide1
Slide2
Slide3
Slide4
Slide5

None of these mutation will inevitably harm the persons that displays any of them. Just like them, there are thousands of possible genetic arrangements that will result in perfectly fine humans. Still don’t believe it? Just look around when there’s people around you. With very few exceptions like in the case of identical twins, everybody is different, not only in their external appearance, but also in their biochemistry, their physiology, etc. This means that barring any abnormalities, we all have the same genes that code for the same traits, but genes (the genotype) may be subtly different (with changes in the DNA sequence) that will account for differences in the phenotype.

So you see, just in the same sense that there are no biological races, let alone no pure biological races, everybody, you, me and everybody else, is a mutant. We may explore some additional aspects of mutations in future posts.

If you liked this, tell your friends about it; if you did not, well, tell them anyway!

You can find my FB page here. (:-)

X-Men-Days-Of-Future-Past-X-Men-Days-Of-Future-Past

Picture credit:http://www.scifinow.co.uk/wp-content/uploads/2013/02/X-Men-Days-Of-Future-Past-X-Men-Days-Of-Future-Past.jpg

About these ads

4 thoughts on “We are all mutants

  1. Actually, the Viking ancestry is likely correct but, although Vikings were dominating warriors, the allele that codes for red hair is recessive and you need two copies to express the trait. Skin tone and (I think) freckling are controlled by several genes and the expression is on a continuum rather than all or nothing.

    I agree, this is a particularly good post.

  2. Good post One’! I particularly like the revelation that my curly hair is dominant ;-) My partner is a ginge (hair like carrots, multifreckles) which she claims is due to dominant Viking ancestry. So each of us knows herself to be the boss and we get along just fine.

    Being serious again… What name do you prefer for microsatellite repeats and VNTRs? As you know, many of those are nonsense mutations but some can be v serious.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s